Advancing genomics.
Enabling precision medicine.
Transforming health.

An independent nonprofit advancing genomics, precision medicine, biomedical research and public health innovation across Nigeria and Africa.

DNA double helix structure representing genomics research

Genomics Research

Advancing African-led science

Our Mission

Centre-GPMI advances genomics and precision medicine research, builds scientific capacity, and expands health equity across Nigeria and Africa, partnering with the global health community to close gaps in disease prevention, diagnosis, and treatment for underserved populations.

ATCGGCTAATCGCGTACGATTGCAGCTAGCTAGGCATCGATCGATGCTAGCTAGCTAGCATCGATCGGCTAATCGGCTAATCGCGTACGATTGCAGCTAGCTAGGCATCGATCGATGCTAGCTAGCTAGCATCGATCGGCTA

“Our vision is to ensure that Africa is not merely a consumer of genomic innovation but an active contributor to the discoveries shaping the future of healthcare.”

Dr. Yohanna Musa Usman, Founder & Executive Director/CEO

Our Mission

Closing the gap between discovery and care

Centre-GPMI exists to advance genomics and precision medicine research, capacity, and awareness that improve health outcomes across Nigeria and Africa, ensuring the continent is not merely a consumer of genomic innovation but an active contributor to the discoveries shaping the future of healthcare.

Research Excellence

Rigorous, ethically grounded research generating African-relevant genomic evidence.

Capacity Building

Training the clinicians, scientists, and public health leaders precision medicine requires.

Continental Impact

A vision that extends from Plateau State to a genomics ecosystem spanning Africa.

Strategic Focus

Four focus areas guiding our work

01

Health Genomics & Precision Medicine

Advancing genomic literacy, genetic testing infrastructure, and individualized treatment pathways across Nigeria and Africa.

02

Precision Public Health

Applying population-level genomic and epidemiological data to design targeted, evidence-based public health interventions.

03

Health Systems Strengthening

Building institutional capacity, governance frameworks, and referral pathways that make precision healthcare deliverable at scale.

04

Digital Health & Bioinformatics

Deploying data platforms, computational pipelines, and digital tools that translate genomic data into clinical and policy action.

Where Our Work Matters

Genomics across disease areas

Precision medicine isn’t limited to one category of illness. Our work spans both the infections that spread between people and the conditions that develop within them.

Infectious Diseases

Genomic tools help us understand how pathogens evolve, track outbreaks in real time, and identify why some individuals are more genetically susceptible to infections like malaria, tuberculosis, and HIV than others. This knowledge shapes faster diagnostics and more targeted treatment protocols.

Non-Communicable Diseases

From sickle cell disease to cancers, diabetes, and cardiovascular conditions, many of Africa's leading health burdens have a genetic component. Precision medicine allows us to move beyond one-size-fits-all treatment, tailoring prevention, screening, and care to each patient's genetic profile.

Pharmacogenomics & Drug Response

Not everyone responds to the same medication the same way, and genetics is often why. Our research into pharmacogenomics identifies these genetic differences, so treatment and dosage can be matched to a patient's biology rather than guessed at.

Research & Publications

Where our evidence comes from

View research & publications
Human GenomicsPrecision MedicineMolecular DiagnosticsBioinformaticsInfectious DiseasesHealth Systems Research

Newsroom

Latest from Centre-GPMI

All news
Centre-GPMI to Host Inaugural Breast Cancer Symposium in Vom, Plateau State
Event

Centre-GPMI to Host Inaugural Breast Cancer Symposium in Vom, Plateau State

August 2026

Centre-GPMI Signs MOU with University of Jos Human Genomics and Bioinformatics Research Laboratory
Partnership

Centre-GPMI Signs MOU with University of Jos Human Genomics and Bioinformatics Research Laboratory

July 2026

Clinician Workshop on Sickle Cell Genomics Held in Jos
Outreach

Clinician Workshop on Sickle Cell Genomics Held in Jos

July 2026

First Cohort of Research Fellows Begins Onboarding
Training

First Cohort of Research Fellows Begins Onboarding

June 2026

Centre-GPMI to Present at Africa Genomics Forum
Conference

Centre-GPMI to Present at Africa Genomics Forum

May 2026

Centre-GPMI Launches Genomic Literacy Pilot in Plateau State
Announcement

Centre-GPMI Launches Genomic Literacy Pilot in Plateau State

March 2026

Centre-GPMI to Host Inaugural Breast Cancer Symposium in Vom, Plateau State
Event

Centre-GPMI to Host Inaugural Breast Cancer Symposium in Vom, Plateau State

August 2026

Centre-GPMI Signs MOU with University of Jos Human Genomics and Bioinformatics Research Laboratory
Partnership

Centre-GPMI Signs MOU with University of Jos Human Genomics and Bioinformatics Research Laboratory

July 2026

Clinician Workshop on Sickle Cell Genomics Held in Jos
Outreach

Clinician Workshop on Sickle Cell Genomics Held in Jos

July 2026

First Cohort of Research Fellows Begins Onboarding
Training

First Cohort of Research Fellows Begins Onboarding

June 2026

Centre-GPMI to Present at Africa Genomics Forum
Conference

Centre-GPMI to Present at Africa Genomics Forum

May 2026

Centre-GPMI Launches Genomic Literacy Pilot in Plateau State
Announcement

Centre-GPMI Launches Genomic Literacy Pilot in Plateau State

March 2026

Let’s build Africa’s genomics future together

Whether you are a research institution, funder, hospital, volunteer, or government agency, there is a place for you in this work.

Donate